Methods amplification plot of synthetic DNA with a length of 547 BP
Methods amplification plot of synthetic DNA with a length of 547 BP (experiment conducted by P. gariaev)
in the system-polymerase chain reaction using mšèi spectra of a DNA product obtained by the laser system.
Step 1. The initial DNA product
As the initial DNA product was captured PCR product with a length of 547 BP, for which used cloned into plasmid vector the synthetic sequence.
Zero chain DNA:
5′-CCTTACGTCAGTGGAGATGTCACATCAATCAACTTGCTTTGAAGACGTGGTTGGAA CGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTGAATGATAGCCTTTCCTTTATCGCAATG
ATGGCATTTGTAGGAGCCACCTTCCTTTTCTACTGTCCTTGCGCGCTATATTTTGTTTTCTATCGCGTATTAAATGTATAATTGGGGGACTCTAATCATA
AAAACCCATCTCATAAATAACGTCATGCATTACATGTTAATTATTACATGCTTAACGTAATTCAACAGAAATTATATGATAATCATCGCAAGACCGGCAA
CAGGATTCAATCTTAAGAAACTTTATTGCACGCATTAATGGACTGGATTGGGGCCAACTCCTACCGTACCTGGCATTACCCTTACGCTGAAGAGATGCTC
GACTGGGCAGATGAACATGGCATCGTGGTGATTGATGAAACTGCTGCTGTCGGCTTTAACCTCTCTTTAGGCATTGGTTTGGAAGCGGGCA-3′
For PCR amplification of DNA product using a pair of primers:
5′-CCTTACGTCAGTGGAGATGTCACATC-3′;
5′-TGCCCGCTTCCAAACCAATGCCTAAAGA-3′.
Each PCR mix of final volume of 25 µl contained: 67 mm Tris-HCl pH to 8.6 at 25°C; 2.5 mm magnesium chloride; 16.6 mm ammonium sulfate; a mixture of dNTPs in a total concentration of 300 µm; a mixture of primers 0.5 µm each; and 2.5 units Taq DNA polymerase and plasmid DNA-matrix in an amount of 25 ng. Temperature conditions of PCR included:
initial denaturation at 94°C – 3 min.;
30 cycles: 94°C – 30s, 62°C – 30 s, 72°C – 40 s;
the final synthesis at 72°C for 5 minutes.
The PCR product was purified from primers and components of the PCR reaction using the kit for purification using SiO2 magnetic particles (“Silex”, Russia) in accordance with the manufacturer’s recommendations. Used 10 µl of magnetic particles with a binding capacity of 10 µg of DNA. Luciu DNA was performed in a total volume of 50 ál of buffer for elution.
Step 2. Getting mšèi DNA spectrum product.
A drop of an aqueous solution of PCR product in a volume of 25 µl was applied on a clean glass slide and used for sensing the beam of a helium-neon laser from 3 min. And above. Received secondary modulated broadband electromagnetic radiation (mšèi) recorded a transistor radio at a frequency of 700 kHz and converted into sound wave format. This audio file, we propose to use for the introduction of DNA information (without, in this embodiment, the laser) in samples of sterile water, meaning that the sound contains torsion information http://www.efir.com.ua/rus/a.php?r=2&d=69 , including DNA (the hypothesis). This acoustic-torsion version of quantum cloning DNA is given in a separate file.
At a distance of 15-20 cm from the laser beam was a stand with test tubes containing purified distilled water free of impurities, DNA, RNA and nucleases. The water was pre-frozen at -20°C and thawed at room temperature (melt water).
Step 3. PCR amplification using samples of water treated mšèi spectrum DNA product
After laser exposure, the water treated mšèi spectrum, used for setting a standard PCR reactions with a volume of 25 ál without adding physical DNA-matrix. PCR reactions were performed in the sterile, processed with UV light, eliminating the contamination of the samples.
Each PCR mixture contained 67 mm Tris-HCl pH to 8.6 at 25°C; 2.5 mm magnesium chloride; 16.6 mm ammonium sulfate; a mixture of dNTPs in a total concentration of 300 µm; a mixture of primers 0.5 µm each; and 2.5 units of Taq DNA polymerase. Used several temperature regimes PCR, wherein the duration of the elongation phase (synthesis) DNA strands at 72°C.
The original temperature regime of PCR included:
initial denaturation at 94°C – 3 min.;
40 cycles: 94°C – 30s, 62°C – 30 s, 72°C – 40 s;
the final synthesis at 72°C for 5 minutes.
Modified the temperature regime of PCR included:
initial denaturation at 94°C – 3 min.;
40 cycles: 94°C – 30s, 62°C – 30 s, 72°C – 2-7 min.;
the final synthesis at 72°C for 5-7 minutes.
All temperature regimes led to the synthesis of the PCR-product of given length, but in varying degrees. The large number of experimental samples of the target product was observed using the 7-minute synthesis of DNA chains in each of the 40 PCR cycles.
Step 4. Analysis of PCR results
After completion of PCR reaction the samples were mixed with buffer to cover the gel containing the fluorescent dye SYBR Green I (“Silex”, Russia) and analyzed in 1.5% agarose gel according to standard methods of carrying out gel electrophoresis in a single SBA-buffer. The results were analyzed on transilluminator with the length of UV wavelengths 365nm. Considered positive samples, the bands in which were located the same distance from the start, as the band of positive control, corresponding to the size of the DNA fragment of 547 BP
Sequencing was subjected to experimental samples, positive control, PCR and samples of the original DNA product, which was produced by the laser scanning. Sequencing showed that the experimental samples of 99.2-100% identical to the original DNA sequence, which produced a readout laser.
The sound copy of mBER DNA in wave a format as a way of introduction of genetic information to water. This development of ideas of L. Montanye of
mBER (Polarization-Laser-Radiowave ) is the Modulated Broadband Electromagnetic laser Radiation received as secondary when sounding drug DNA (plazmidny DNA a matrix, 25 ng, 30 cycles PTsR). Other details of a method in the preparing article).
1.-14. – the purified water previously frozen and defrozen (thawed), processed by a sound mBER (wave the file) within 30 minutes before statement of PTsR.
Test tubes with water exhibited mBER sound from below via the loudspeaker. Water was used same, as in PTsR when studying a background to mBER sound. The background yielded zero result concerning synthesis of plazmidny DNA in the same PTsR to system. It is control on lack of kontamination (pollution) of background plazmidny DNA.
In experience the first 4 test tubes did not give a product, i.e. plazmidny DNA. Perhaps, it is connected with fluctuations of mBER not studied). The sequencing of the product received by DNA showed to 99% coincidence to plazmidny DNA a matrix with which carried out reading of information by the laser.
15. – Positive control of PTsR (plazmidny DNA matrix 25 ng, 30 cycles PTsR)
16. – Marker of lengths of fragments 139, 268, 450, 613 items of N.
Are given the description of possible mechanisms of generation of mBER in a number of our articles. I give the reference to one of them:
UDC 575.17 SPECTROSCOPY of RADIO WAVE RADIATIONS of the LOCALIZED PHOTONS: EXIT TO QUANTUM and NONLOCAL BIOINFORMATION PROCESSES I. V. Prangishvili, P.P. Garyaev, G.G. Tertyshny, V. V. Maksimenko, A. V. Mologin, E. A. Leonova, E.R.Muldashev.
Sensors and Systems, No. 9 (18), page 2-13 (2000)
We offer you experimental polarization laser spectrometer for experiments in Wave Genetics.